Model description of the response¶
Warning
This step is optional and is required only if the related API does not return JSON format. Its main purpose at the moment is to help you build parsers.
Models description are done using pydantic. In brief, it uses Python type annotations to perform validations. Please check to Pydantic models documentation for more details.
Note
This step is done manually at the moment, but we could imagine using or creating a tool that generates, in a semi-automatic manner the base structure for the response based on a openapi specification.
All the models are present in the models module of the dabeplech library.
Describing your response should be pretty straightforward and is only a matter of defining the structure of it. Let’s have a look at a simple example.
Example¶
Let’s say your API return some information about a gene:
{
'gene_id': 'gene-3529',
'name': 'Illestere',
'sequence': 'acgtatcgaacagcatgcatgt'
}
You could therefore describe your response as followed:
from pydantic import BaseModel
class GeneModel(BaseModel):
gene_id: str
name: str
sequence: str
It is as simple as that!
Note
Structure can be way more complex, with nested structure, regex validation, non mandatory fields… You can find all you need on the Pydantic models documentation.